Product Details

SNP ID: rs3830026
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:116664061 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCAGGGCAGCTTCCATCTAGGAGAG[A/G]AACCGTCCGTGTGAGTTGCAGGGAG
Phenotype: MIM: 610701
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C10orf82 PubMed Links

Gene Details

Gene: C10orf82
Gene Name: chromosome 10 open reading frame 82

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144661.2	629	UTR 3			NP_653262.1
XM_011539340.2	629	Intron			XP_011537642.1
XM_011539341.1	629	Intron			XP_011537643.1
XM_011539342.2	629	Intron			XP_011537644.1
XM_011539343.2	629	Intron			XP_011537645.1
XM_011539344.2	629	Intron			XP_011537646.1
XM_011539345.2	629	Intron			XP_011537647.1
XM_011539346.2	629	Intron			XP_011537648.1
XM_011539347.2	629	UTR 3			XP_011537649.1
XM_017015753.1	629	Intron			XP_016871242.1
XM_017015754.1	629	Intron			XP_016871243.1
XM_017015755.1	629	Intron			XP_016871244.1

Gene: HSPA12A
Gene Name: heat shock protein family A (Hsp70) member 12A

There are no transcripts associated with this gene.

Gene: LOC105378499
Gene Name: uncharacterized LOC105378499

There are no transcripts associated with this gene.

View Full Product Details