Product Details

SNP ID: rs2272213
Assay Type: Functionally tested
NCBI dbSNP Submissions: 8
Location: Chr.1:151051069 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: AATTACGACTCTCAAACCCATTCCC[A/G]TCACTTTATTAGTGATGGTAGCATA
Phenotype: MIM: 611275 MIM: 604684
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BNIPL PubMed Links

Gene Details

Gene: BNIPL
Gene Name: BCL2 interacting protein like

There are no transcripts associated with this gene.

Gene: C1orf56
Gene Name: chromosome 1 open reading frame 56

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017860.3	1702	UTR 3			NP_060330.2

Gene: CDC42SE1
Gene Name: CDC42 small effector 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001038707.1	1702	UTR 3			NP_001033796.1
NM_020239.3	1702	UTR 3			NP_064624.1
XM_017001847.1	1702	UTR 3			XP_016857336.1

Gene: MLLT11
Gene Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11

There are no transcripts associated with this gene.

View Full Product Details