Product Details

SNP ID: rs3744406
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7356349 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCCTTGGGCTCCCAAGTCGGTGCG[C/T]GTGGGTCCCAGAATCATTCACTGCC
Phenotype: MIM: 607763 MIM: 609848
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACAP1 PubMed Links

Gene Details

Gene: ACAP1
Gene Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1

There are no transcripts associated with this gene.

Gene: KCTD11
Gene Name: potassium channel tetramerization domain containing 11

There are no transcripts associated with this gene.

Gene: TMEM95
Gene Name: transmembrane protein 95

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320435.1		Intron			NP_001307364.1
NM_001320436.1		Intron			NP_001307365.1
NM_198154.2		Intron			NP_937797.1
XM_017024565.1		Intron			XP_016880054.1
XM_017024566.1		Intron			XP_016880055.1
XM_017024567.1		Intron			XP_016880056.1
XM_017024568.1		Intron			XP_016880057.1
XM_017024569.1		Intron			XP_016880058.1
XM_017024570.1		Intron			XP_016880059.1
XM_017024571.1		Intron			XP_016880060.1

View Full Product Details