Product Details

SNP ID: rs142427839
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:71455798 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTTTGTGGGGAGGGCGTAGTTCCT[A/T]ATCCCCTTTCCGGGCAGCCGCCGGG
Phenotype: MIM: 607012
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: BDP1 PubMed Links

Gene Details

Gene: BDP1
Gene Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018429.2	163	UTR 5			NP_060899.2
XM_011543511.2	163	UTR 5			XP_011541813.1
XM_011543512.2	163	UTR 5			XP_011541814.1
XM_017009630.1	163	UTR 5			XP_016865119.1
XM_017009631.1	163	UTR 5			XP_016865120.1
XM_017009632.1	163	UTR 5			XP_016865121.1
XM_017009633.1	163	UTR 5			XP_016865122.1
XM_017009634.1	163	UTR 5			XP_016865123.1

Gene: LOC102724392
Gene Name: uncharacterized LOC102724392

There are no transcripts associated with this gene.

View Full Product Details