Product Details

SNP ID: rs4624073
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24234847 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGATGATAGAGTTGTTGAGAAAGCA[A/G]AATTCAATACCAGCTTTAGCTAGAT
Phenotype: MIM: 610781 MIM: 603171 MIM: 604319
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GMPR2 PubMed Links

Gene Details

Gene: GMPR2
Gene Name: guanosine monophosphate reductase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002000.2		Intron			NP_001002000.1
NM_001002001.2		Intron			NP_001002001.1
NM_001002002.2		Intron			NP_001002002.1
NM_001283021.1		Intron			NP_001269950.1
NM_001283022.1		Intron			NP_001269951.1
NM_001283023.1		Intron			NP_001269952.1
NM_016576.4		Intron			NP_057660.2

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TINF2
Gene Name: TERF1 interacting nuclear factor 2

There are no transcripts associated with this gene.

View Full Product Details