Product Details

SNP ID: rs6969584
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100612124 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAATCGGCGTATAGTTACGGCAGA[A/C]ACAAAGACGTCCTAGCCAATGACAG
Phenotype: MIM: 609125 MIM: 600270 MIM: 604720
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MOSPD3 PubMed Links

Gene Details

Gene: MOSPD3
Gene Name: motile sperm domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040097.1	23	UTR 5			NP_001035186.1
NM_001040098.1	23	Intron			NP_001035187.1
NM_001040099.1	23	Intron			NP_001035188.1
NM_023948.4	23	Intron			NP_076438.1
XM_005250529.4	23	Intron			XP_005250586.1
XM_005250531.3	23	Intron			XP_005250588.1

Gene: PCOLCE
Gene Name: procollagen C-endopeptidase enhancer

There are no transcripts associated with this gene.

Gene: PCOLCE-AS1
Gene Name: PCOLCE antisense RNA 1

There are no transcripts associated with this gene.

Gene: TFR2
Gene Name: transferrin receptor 2

There are no transcripts associated with this gene.

View Full Product Details