Product Details
- SNP ID
-
rs12025679
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
10
- Location
-
Chr.1:78648565 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTATAAGAACTAACTCACTATGATG[C/T]GAACTGCCCCATGATTCAATTATCT
- Phenotype
-
MIM: 610468
MIM: 613975
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
IFI44
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs74592656] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- IFI44
- Gene Name
- interferon induced protein 44
- Gene
- IFI44L
- Gene Name
- interferon induced protein 44 like
There are no transcripts associated with this gene.
View Full Product Details