Product Details
- SNP ID
-
rs3916897
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:45351103 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAAAGGCAGGGCGGTCGGGCCAGTG[G/T]TGGAGTCAGCAGGTGGTGGGTTGGT
- Phenotype
-
MIM: 126340
MIM: 601334
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ERCC2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs3916896] are located under a probe and SNP(s) [rs3916898] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ERCC2
- Gene Name
- ERCC excision repair 2, TFIIH core complex helicase subunit
- Gene
- KLC3
- Gene Name
- kinesin light chain 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_177417.2 |
2838 |
Intron |
|
|
NP_803136.2 |
View Full Product Details