Product Details

SNP ID: rs9273916
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32661969 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACAGAAACTCAATATCCCCTTACGC[C/G]ACTCCACGGTGATGGGGCTCTGGAG
Phenotype: MIM: 146880 MIM: 604305
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: HLA-DQA1 PubMed Links

Gene Details

Gene: HLA-DQA1
Gene Name: major histocompatibility complex, class II, DQ alpha 1

There are no transcripts associated with this gene.

Gene: HLA-DQB1
Gene Name: major histocompatibility complex, class II, DQ beta 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243961.1	741	Missense Mutation	TCG,TGG	S220W	NP_001230890.1
NM_001243962.1	741	Missense Mutation	TCG,TGG	S220W	NP_001230891.1
NM_002123.4	741	Missense Mutation	TCG,TGG	S220W	NP_002114.3

Gene: HLA-DQB1-AS1
Gene Name: HLA-DQB1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details