Product Details

SNP ID: rs28382850
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57517652 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGACTATAGGACTTTTAACATCTAA[A/T]ATATTTACTGTCCTGCCGTTTAAAA
Phenotype: MIM: 126337 MIM: 156560 MIM: 614489
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: DDIT3 PubMed Links

Gene Details

Gene: DDIT3
Gene Name: DNA damage inducible transcript 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195053.1	202	Intron			NP_001181982.1
NM_001195054.1	202	Intron			NP_001181983.1
NM_001195055.1	202	Intron			NP_001181984.1
NM_001195056.1	202	UTR 5			NP_001181985.1
NM_001195057.1	202	Intron			NP_001181986.1
NM_004083.5	202	Intron			NP_004074.2

Gene: MARS
Gene Name: methionyl-tRNA synthetase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004990.3	202	Intron			NP_004981.2
XM_006719398.3	202	Intron			XP_006719461.1

Gene: MBD6
Gene Name: methyl-CpG binding domain protein 6

There are no transcripts associated with this gene.

Gene: MIR616
Gene Name: microRNA 616

There are no transcripts associated with this gene.

Gene: MIR6758
Gene Name: microRNA 6758

There are no transcripts associated with this gene.

View Full Product Details