Product Details

SNP ID: rs7198357
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.16:67850716 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGGCATGCGGTGGTTGGGATATTGC[C/T]GCACAAGGATGAGGCAGGATACAAG
Phenotype: MIM: 611510 MIM: 605813 MIM: 609119
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CENPT PubMed Links

Gene Details

Gene: CENPT
Gene Name: centromere protein T

There are no transcripts associated with this gene.

Gene: NUTF2
Gene Name: nuclear transport factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001322038.1		Intron			NP_001308967.1
NM_001322039.1		Intron			NP_001308968.1
NM_001322040.1		Intron			NP_001308969.1
NM_001322041.1		Intron			NP_001308970.1
NM_005796.2		Intron			NP_005787.1

Gene: THAP11
Gene Name: THAP domain containing 11

There are no transcripts associated with this gene.

View Full Product Details