Product Details

SNP ID: rs555316
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 32
Location: Chr.1:166604016 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGAACTTTCTAATAATCAGAGCTT[A/T]TTGAAAATGAATATACTGTCTATGA
Phenotype
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: FMO9P PubMed Links
Additional Information: For this assay, SNP(s) [rs115547854] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.