Product Details

SNP ID: rs35117064
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6475280 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAACCGCCTCAACCTCTTATCCAC[C/T]TGAGTTCAGCACATAGCACAAGATG
Phenotype: MIM: 601638 MIM: 607388 MIM: 605493
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARFIP2 PubMed Links

Gene Details

Gene: ARFIP2
Gene Name: ADP ribosylation factor interacting protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242854.1	3110	UTR 3			NP_001229783.1
NM_001242855.1	3110	UTR 3			NP_001229784.1
NM_001242856.1	3110	UTR 3			NP_001229785.1
NM_012402.3	3110	UTR 3			NP_036534.1
XM_005252840.4	3110	UTR 3			XP_005252897.1

Gene: TIMM10B
Gene Name: translocase of inner mitochondrial membrane 10 homolog B (yeast)

There are no transcripts associated with this gene.

Gene: TRIM3
Gene Name: tripartite motif containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001248006.1	3110	Intron			NP_001234935.1
NM_001248007.1	3110	Intron			NP_001234936.1
NM_006458.3	3110	Intron			NP_006449.2
NM_033278.3	3110	Intron			NP_150594.2
XM_011519844.1	3110	Intron			XP_011518146.1
XM_011519845.2	3110	Intron			XP_011518147.1
XM_017017098.1	3110	Intron			XP_016872587.1
XM_017017099.1	3110	Intron			XP_016872588.1

View Full Product Details