Product Details

SNP ID: rs456261
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:33290666 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TCTTGCGTTTAGCACTCTCCATAGT[A/G]AGTCCTACTAATTTCTCCCTTTCTG
Phenotype: MIM: 605660 MIM: 602306 MIM: 601962 MIM: 611440
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6834 PubMed Links

Gene Details

Gene: MIR6834
Gene Name: microRNA 6834

There are no transcripts associated with this gene.

Gene: MIR6873
Gene Name: microRNA 6873

There are no transcripts associated with this gene.

Gene: PFDN6
Gene Name: prefoldin subunit 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001185181.2		Intron			NP_001172110.1
NM_001265595.1		Intron			NP_001252524.1
NM_001265596.1		Intron			NP_001252525.1
NM_014260.3		Intron			NP_055075.1

Gene: RGL2
Gene Name: ral guanine nucleotide dissociation stimulator like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243738.1		Intron			NP_001230667.1
NM_004761.4		Intron			NP_004752.1
XM_011514781.1		Intron			XP_011513083.1
XM_011514785.2		Intron			XP_011513087.1

Gene: TAPBP
Gene Name: TAP binding protein (tapasin)

There are no transcripts associated with this gene.

Gene: WDR46
Gene Name: WD repeat domain 46

There are no transcripts associated with this gene.

View Full Product Details