Product Details

SNP ID: rs12981222
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55642973 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCGCCGCACACCTGCCCGCTCTG[C/T]CCACGCCGCTTCCAGGACGCCGCGG
Phenotype: MIM: 613478
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC106 PubMed Links

Gene Details

Gene: CCDC106
Gene Name: coiled-coil domain containing 106

There are no transcripts associated with this gene.

Gene: LOC107983998
Gene Name: uncharacterized LOC107983998

There are no transcripts associated with this gene.

Gene: ZNF580
Gene Name: zinc finger protein 580

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163423.1	635	Silent Mutation	TGC,TGT	C155C	NP_001156895.1
NM_016202.2	635	Silent Mutation	TGC,TGT	C155C	NP_057286.1
NM_207115.1	635	Silent Mutation	TGC,TGT	C155C	NP_996998.1

Gene: ZNF581
Gene Name: zinc finger protein 581

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016535.3	635	Intron			NP_057619.1
XM_006723240.3	635	Intron			XP_006723303.1
XM_017026867.1	635	Intron			XP_016882356.1

View Full Product Details