Product Details

SNP ID
rs943851
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.9:131577294 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
CTGCTCAGAACACCAAGGGCTCCCA[A/G]TGAGGGCCTGGGGAATTGCCTGGGC
Phenotype
MIM: 600303
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
RAPGEF1 PubMed Links
Additional Information
For this assay, SNP(s) [rs113972469] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
RAPGEF1
Gene Name
Rap guanine nucleotide exchange factor 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001304275.1 5650 UTR 3 NP_001291204.1
NM_005312.3 5650 UTR 3 NP_005303.2
NM_198679.1 5650 UTR 3 NP_941372.1
XM_005272186.4 5650 UTR 3 XP_005272243.1
XM_005272191.3 5650 UTR 3 XP_005272248.1
XM_006717067.3 5650 UTR 3 XP_006717130.1
XM_006717072.3 5650 UTR 3 XP_006717135.1
XM_006717074.3 5650 UTR 3 XP_006717137.1
XM_011518569.2 5650 UTR 3 XP_011516871.1
XM_011518570.2 5650 UTR 3 XP_011516872.1
XM_011518571.2 5650 UTR 3 XP_011516873.1
XM_011518572.2 5650 UTR 3 XP_011516874.1
XM_011518573.2 5650 UTR 3 XP_011516875.1
XM_011518574.2 5650 UTR 3 XP_011516876.1
XM_011518575.2 5650 UTR 3 XP_011516877.1
XM_011518576.2 5650 UTR 3 XP_011516878.1
XM_011518577.2 5650 UTR 3 XP_011516879.1
XM_011518578.2 5650 UTR 3 XP_011516880.1
XM_011518579.2 5650 UTR 3 XP_011516881.1
XM_011518580.2 5650 Intron XP_011516882.1
XM_011518581.2 5650 Intron XP_011516883.1
XM_011518582.2 5650 Intron XP_011516884.1
XM_017014633.1 5650 UTR 3 XP_016870122.1
XM_017014634.1 5650 UTR 3 XP_016870123.1
XM_017014635.1 5650 UTR 3 XP_016870124.1
XM_017014636.1 5650 UTR 3 XP_016870125.1
XM_017014637.1 5650 UTR 3 XP_016870126.1
XM_017014638.1 5650 UTR 3 XP_016870127.1
XM_017014639.1 5650 UTR 3 XP_016870128.1
XM_017014640.1 5650 Intron XP_016870129.1
XM_017014641.1 5650 Intron XP_016870130.1

View Full Product Details