gRNA Design Details

Target DNA Sequence
GGGTTTCCACCATTAGCACG
PAM Sequence
CGG
Target locus
Chr.19: 41352696 - 41352718 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 98.36/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
TGFB1
Entrez Gene ID
7040
Gene Name
transforming growth factor beta 1
Gene Aliases
CED, DPD1, LAP, TGFB, TGFbeta
Chromosome Location
Chr.19: 41330531 - 41353933 on GRCh38
UniGene ID
Hs.645227
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000660.5 NP_000651.3 1
XM_011527242.1 XP_011525544.1 1