gRNA Design Details

Target DNA Sequence
ATCCGGGATACCGATATGAC
PAM Sequence
CGG
Target locus
Chr.18: 59469510 - 59469532 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 96.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
CCBE1
Entrez Gene ID
147372
Gene Name
collagen and calcium binding EGF domains 1
Gene Aliases
HKLLS1
Chromosome Location
Chr.18: 59430939 - 59698181 on GRCh38
UniGene ID
Hs.34333
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_133459.3 NP_597716.1 4
XM_017025556.1 XP_016881045.1 4
XM_017025557.1 XP_016881046.1 5
XM_017025558.1 XP_016881047.1 4