gRNA Design Details

Target DNA Sequence
TGAGTGTCTACTGAAAGAAT
PAM Sequence
TGG
Target locus
Chr.17: 55784978 - 55785000 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 81.19/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Adgre4
Entrez Gene ID
52614
Gene Name
adhesion G protein-coupled receptor E4
Gene Aliases
D17Ertd479e, Egf-tm7, Emr4, Fire, Gpr127
Chromosome Location
Chr.17: 55749984 - 55853662 on GRCm38
UniGene ID
Mm.210497
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_139138.3 NP_631877.2 5