gRNA Design Details

Target DNA Sequence
CTTGTGGTGAGTGTGCACGG
PAM Sequence
AGG
Target locus
Chr.5: 107177895 - 107177917 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 89.87/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Tgfbr3
Entrez Gene ID
21814
Gene Name
transforming growth factor, beta receptor III
Gene Aliases
1110036H20Rik, AU015626, AW215636, TBRIII
Chromosome Location
Chr.5: 107106570 - 107289595 on GRCm38
UniGene ID
Mm.200775
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_011578.3 NP_035708.2 4