gRNA Design Details

Target DNA Sequence
AGCACTGGGTCAACCCTTGC
PAM Sequence
AGG
Target locus
Chr.11: 95891812 - 95891834 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 81.97/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
B4galnt2
Entrez Gene ID
14422
Gene Name
beta-1,4-N-acetyl-galactosaminyl transferase 2
Gene Aliases
AI593864, Dlb-1, Dlb1, Galg2, Galgt2, Ggm3, Igf2bp1
Chromosome Location
Chr.11: 95863559 - 95914920 on GRCm38
UniGene ID
Mm.340702
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008081.3 NP_032107.1 2