gRNA Design Details

Target DNA Sequence
GCTTTTGGCTGCTCCTCTTC
PAM Sequence
TGG
Target locus
Chr.17: 57358733 - 57358755 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 84.02/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Adgre1
Entrez Gene ID
13733
Gene Name
adhesion G protein-coupled receptor E1
Gene Aliases
DD7A5-7, EGF-TM7, Emr1, F4/80, Gpf480, Ly71, TM7LN3
Chromosome Location
Chr.17: 57358651 - 57483529 on GRCm38
UniGene ID
Mm.2254
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_010130.4 NP_034260.1 1