gRNA Design Details

Target DNA Sequence
TTAGCGAACACCAAGTCCCC
PAM Sequence
GGG
Target locus
Chr.19: 4472369 - 4472391 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.03/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
HDGFRP2
Entrez Gene ID
84717
Gene Name
hepatoma-derived growth factor-related protein 2
Gene Aliases
HDGF-2, HDGF2, HRP-2
Chromosome Location
Chr.19: 4472196 - 4502220 on GRCh38
UniGene ID
Hs.43071
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001001520.2 NP_001001520.1 1
NM_032631.3 NP_116020.1 1