gRNA Design Details

Target DNA Sequence
TGAACGCACCTTTTACCTGG
PAM Sequence
TGG
Target locus
Chr.11: 78280682 - 78280704 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 86.74/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GAB2
Entrez Gene ID
9846
Gene Name
GRB2 associated binding protein 2
Gene Aliases
-
Chromosome Location
Chr.11: 78215290 - 78417822 on GRCh38
UniGene ID
Hs.429434
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_012296.3 NP_036428.1 2
NM_080491.2 NP_536739.1 2
XM_006718753.2 XP_006718816.1 3
XM_011545408.2 XP_011543710.1 2