gRNA Design Details

Target DNA Sequence
TATTCCACCCCAGCTCCGAT
PAM Sequence
GGG
Target locus
Chr.17: 49025642 - 49025664 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.72/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
IGF2BP1
Entrez Gene ID
10642
Gene Name
insulin like growth factor 2 mRNA binding protein 1
Gene Aliases
CRD-BP, CRDBP, IMP-1, IMP1, VICKZ1, ZBP1
Chromosome Location
Chr.17: 48997412 - 49056145 on GRCh38
UniGene ID
Hs.144936
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001160423.1 NP_001153895.1 3
NM_006546.3 NP_006537.3 3
XM_005256955.3 XP_005257012.2 2
XM_011524201.2 XP_011522503.1 3
XM_017024022.1 XP_016879511.1 3