gRNA Design Details

Target DNA Sequence
CACAAACAACATTGCTGAGG
PAM Sequence
GGG
Target locus
Chr.1: 154430523 - 154430545 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 84.66/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
IL6R
Entrez Gene ID
3570
Gene Name
interleukin 6 receptor
Gene Aliases
CD126, IL-6R-1, IL-6RA, IL6Q, IL6RA, IL6RQ, gp80
Chromosome Location
Chr.1: 154405193 - 154469450 on GRCh38
UniGene ID
Hs.135087
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000565.3 NP_000556.1 3
NM_001206866.1 NP_001193795.1 3
NM_181359.2 NP_852004.1 3
XM_005245139.1 XP_005245196.1 3
XM_005245140.2 XP_005245197.1 3
XM_006711298.1 XP_006711361.1 3
XM_006711299.3 XP_006711362.1 3
XM_017001199.1 XP_016856688.1 3
XM_017001200.1 XP_016856689.1 3
XM_017001201.1 XP_016856690.1 3