gRNA Design Details

Target DNA Sequence
GTCTTCAGATGCCACACCAG
PAM Sequence
GGG
Target locus
Chr.1: 91758650 - 91758672 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 88.94/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
TGFBR3
Entrez Gene ID
7049
Gene Name
transforming growth factor beta receptor 3
Gene Aliases
BGCAN, betaglycan
Chromosome Location
Chr.1: 91680343 - 91906002 on GRCh38
UniGene ID
Hs.482390
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001195683.1 NP_001182612.1 4
NM_001195684.1 NP_001182613.1 5
NM_003243.4 NP_003234.2 4
XM_006710867.2 XP_006710930.1 4
XM_006710868.2 XP_006710931.1 4