gRNA Design Details

Target DNA Sequence
GTCGCAGGTAACACTCATTC
PAM Sequence
TGG
Target locus
Chr.2: 192184414 - 192184436 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.95/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
TMEFF2
Entrez Gene ID
23671
Gene Name
transmembrane protein with EGF like and two follistatin like domains 2
Gene Aliases
CT120.2, HPP1, TENB2, TPEF, TR, TR-2
Chromosome Location
Chr.2: 191948299 - 192194940 on GRCh38
UniGene ID
Hs.144513
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001305134.1 NP_001292063.1 3
NM_001305145.1 NP_001292074.1 3
NM_016192.3 NP_057276.2 3
XM_011510890.2 XP_011509192.1 3
XM_017003739.1 XP_016859228.1 3
XM_017003740.1 XP_016859229.1 3