gRNA Design Details

Target DNA Sequence
CTTCCTTGCATTCGCACACG
PAM Sequence
CGG
Target locus
Chr.8: 118933003 - 118933025 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 97.55/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
TNFRSF11B
Entrez Gene ID
4982
Gene Name
TNF receptor superfamily member 11b
Gene Aliases
OCIF, OPG, PDB5, TR1
Chromosome Location
Chr.8: 118923557 - 118952144 on GRCh38
UniGene ID
Hs.81791
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_002546.3 NP_002537.3 2