gRNA Design Details

Target DNA Sequence
AGCTCCACAAAGAGAGCCAT
PAM Sequence
TGG
Target locus
Chr.5: 91376933 - 91376955 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 83.55/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Btc
Entrez Gene ID
12223
Gene Name
betacellulin, epidermal growth factor family member
Gene Aliases
Bcn
Chromosome Location
Chr.5: 91357261 - 91402994 on GRCm38
UniGene ID
Mm.2024
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_007568.5 NP_031594.1 2