gRNA Design Details

Target DNA Sequence
TGAACTTGCCCAGCTCGATC
PAM Sequence
TGG
Target locus
Chr.18: 56708424 - 56708446 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 85/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Lmnb1
Entrez Gene ID
16906
Gene Name
lamin B1
Gene Aliases
-
Chromosome Location
Chr.18: 56707813 - 56753424 on GRCm38
UniGene ID
Mm.4105
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_010721.2 NP_034851.2 1