gRNA Design Details

Target DNA Sequence
ACATTCCCCGTCAAATTTAC
PAM Sequence
AGG
Target locus
Chr.1: 50930594 - 50930616 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 91.27/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Tmeff2
Entrez Gene ID
56363
Gene Name
transmembrane protein with EGF-like and two follistatin-like domains 2
Gene Aliases
4832418D20Rik, 7630402F16Rik, TR-2
Chromosome Location
Chr.1: 50909962 - 51187270 on GRCm38
UniGene ID
Mm.245154
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_019790.4 NP_062764.1 2