gRNA Design Details

Target DNA Sequence
GTTGCTCTCTCATCTCATGA
PAM Sequence
AGG
Target locus
Chr.5: 126810272 - 126810294 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 88.83/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
LMNB1
Entrez Gene ID
4001
Gene Name
lamin B1
Gene Aliases
ADLD, LMN, LMN2, LMNB
Chromosome Location
Chr.5: 126776623 - 126837020 on GRCh38
UniGene ID
Hs.89497
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001198557.1 NP_001185486.1 4
NM_005573.3 NP_005564.1 4