gRNA Design Details

Target DNA Sequence
TTCCGTGGGAAAATTCCACG
PAM Sequence
TGG
Target locus
Chr.17: 49133043 - 49133065 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 87.61/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
B4GALNT2
Entrez Gene ID
124872
Gene Name
beta-1,4-N-acetyl-galactosaminyltransferase 2
Gene Aliases
B4GALT, GALGT2
Chromosome Location
Chr.17: 49120347 - 49170722 on GRCh38
UniGene ID
Hs.374679
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_153446.2 NP_703147.2 1
XM_011524314.2 XP_011522616.1 1