gRNA Design Details

Target DNA Sequence
TCCATGACGTACACGCGTTC
PAM Sequence
AGG
Target locus
Chr.18: 32310215 - 32310237 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 94.55/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GAREM1
Entrez Gene ID
64762
Gene Name
GRB2 associated regulator of MAPK1 subtype 1
Gene Aliases
C18orf11, FAM59A, GAREM, Gm944
Chromosome Location
Chr.18: 32263521 - 32470518 on GRCh38
UniGene ID
Hs.444314
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001242409.1 NP_001229338.1 3