gRNA Design Details

Target DNA Sequence
CCTGTAGTACTCCAAGACAT
PAM Sequence
CGG
Application
Gene Knock-Out
Score: 92.35/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GAB3
Entrez Gene ID
139716
Gene Name
GRB2 associated binding protein 3
Gene Aliases
-
Chromosome Location
Chr.X: 154675249 - 154751583 on GRCh38
UniGene ID
Hs.496982
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001081573.2 NP_001075042.1 2
NM_001282283.1 NP_001269212.1 2
NM_080612.3 NP_542179.1 2
XM_005274648.1 XP_005274705.1 2
XM_006724804.1 XP_006724867.1 2
XM_011531103.1 XP_011529405.1 2
XM_011531105.1 XP_011529407.1 2
XM_011531106.1 XP_011529408.1 2
XM_017029276.1 XP_016884765.1 2