gRNA Design Details

Target DNA Sequence
TGCGTATCTGGACACCTTTA
PAM Sequence
AGG
Target locus
Chr.8: 17589730 - 17589752 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.63/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
PDGFRL
Entrez Gene ID
5157
Gene Name
platelet derived growth factor receptor like
Gene Aliases
PDGRL, PRLTS
Chromosome Location
Chr.8: 17576433 - 17643133 on GRCh38
UniGene ID
Hs.458573
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_006207.2 NP_006198.1 3