gRNA Design Details

Target DNA Sequence
ATTTCGACCCGGAGAACTGC
PAM Sequence
AGG
Target locus
Chr.12: 4370757 - 4370779 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.49/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FGF23
Entrez Gene ID
8074
Gene Name
fibroblast growth factor 23
Gene Aliases
ADHR, FGFN, HPDR2, HYPF, PHPTC
Chromosome Location
Chr.12: 4368227 - 4379728 on GRCh38
UniGene ID
Hs.287370
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_020638.2 NP_065689.1 3