gRNA Design Details

Target DNA Sequence
GATATACAGTATGGCTATGG
PAM Sequence
TGG
Target locus
Chr.18: 3417581 - 3417603 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 82.51/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Cul2
Entrez Gene ID
71745
Gene Name
cullin 2
Gene Aliases
1300003D18Rik, 4932411N15Rik, AI327301, mKIAA4106
Chromosome Location
Chr.18: 3382975 - 3436700 on GRCm38
UniGene ID
Mm.291707
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_029402.3 NP_083678.2 5