gRNA Design Details

Target DNA Sequence
TCTGTTGCTACACGAAGCGC
PAM Sequence
TGG
Target locus
Chr.8: 40926397 - 40926419 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 88.71/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Pdgfrl
Entrez Gene ID
68797
Gene Name
platelet-derived growth factor receptor-like
Gene Aliases
1110039P19Rik, AV013190
Chromosome Location
Chr.8: 40926233 - 40990782 on GRCm38
UniGene ID
Mm.284246
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_026840.3 NP_081116.3 1