gRNA Design Details

Target DNA Sequence
CGAATAGCTTCACGATGTTC
PAM Sequence
TGG
Target locus
Chr.1: 131275721 - 131275743 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 92.91/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Ikbke
Entrez Gene ID
56489
Gene Name
inhibitor of kappaB kinase epsilon
Gene Aliases
AW558201, IKK-i, IKKepsilon, Ikki
Chromosome Location
Chr.1: 131254600 - 131279625 on GRCm38
UniGene ID
Mm.386783
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_019777.3 NP_062751.2 4