gRNA Design Details

Target DNA Sequence
CACGCAGAACACTAGCACGC
PAM Sequence
AGG
Target locus
Chr.5: 33722422 - 33722444 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 85.15/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Fgfr3
Entrez Gene ID
14184
Gene Name
fibroblast growth factor receptor 3
Gene Aliases
CD333, FR3, Fgfr-3, Flg-2, HBGFR, Mfr3, sam3
Chromosome Location
Chr.5: 33721724 - 33737068 on GRCm38
UniGene ID
Mm.6904
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001163215.2 NP_001156687.1 2
NM_001163216.2 NP_001156688.1 1
NM_001163217.2 NP_001156689.1 1
NM_001205270.1 NP_001192199.1 2
NM_008010.5 NP_032036.2 2