gRNA Design Details

Target DNA Sequence
GACGTATGCTACCAAAGAGG
PAM Sequence
GGG
Target locus
Chr.11: 53433687 - 53433709 on GRCm38
Strand
Forward
Application
Gene Knock-Out
Score: 92.48/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Gdf9
Entrez Gene ID
14566
Gene Name
growth differentiation factor 9
Gene Aliases
Gdf-9
Chromosome Location
Chr.11: 53430878 - 53437903 on GRCm38
UniGene ID
Mm.490461
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008110.2 NP_032136.2 1