gRNA Design Details

Target DNA Sequence
TATGTTCCGAGCCGCTTCCT
PAM Sequence
TGG
Target locus
Chr.5: 98254612 - 98254634 on GRCm38
Strand
Reverse
Application
Gene Knock-Out
Score: 85.22/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Fgf5
Entrez Gene ID
14176
Gene Name
fibroblast growth factor 5
Gene Aliases
Fgf-5, HBGF-5, angora, go
Chromosome Location
Chr.5: 98254184 - 98277033 on GRCm38
UniGene ID
Mm.5055
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001277268.1 NP_001264197.1 1
NM_010203.5 NP_034333.1 1