gRNA Design Details

Target DNA Sequence
ACTCCTCTACTGTAGCAACG
PAM Sequence
GGG
Target locus
Chr.5: 142614025 - 142614047 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 92.5/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FGF1
Entrez Gene ID
2246
Gene Name
fibroblast growth factor 1
Gene Aliases
AFGF, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-1, FGF-alpha, FGFA, GLIO703, HBGF-1, HBGF1
Chromosome Location
Chr.5: 142592178 - 142698070 on GRCh38
UniGene ID
Hs.483635
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000800.4 NP_000791.1 2
NM_001144892.2 NP_001138364.1 2
NM_001144934.1 NP_001138406.1 3
NM_001144935.1 NP_001138407.1 2
NM_001257205.1 NP_001244134.1 2
NM_001257206.1 NP_001244135.1 2
NM_001257207.1 NP_001244136.1 3
NM_001257208.1 NP_001244137.1 2
NM_001257209.1 NP_001244138.1 2
NM_001257210.1 NP_001244139.1 2
NM_001257211.1 NP_001244140.1 2
NM_001257212.1 NP_001244141.1 2
NM_033136.3 NP_149127.1 2
NM_033137.2 NP_149128.1 1
XM_005268390.4 XP_005268447.1 2
XM_011537607.2 XP_011535909.1 3