gRNA Design Details

Target DNA Sequence
TGAGCCGTATAAAAGCCCGT
PAM Sequence
CGG
Target locus
Chr.5: 142600702 - 142600724 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 92.58/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FGF1
Entrez Gene ID
2246
Gene Name
fibroblast growth factor 1
Gene Aliases
AFGF, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-1, FGF-alpha, FGFA, GLIO703, HBGF-1, HBGF1
Chromosome Location
Chr.5: 142592178 - 142698070 on GRCh38
UniGene ID
Hs.483635
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_000800.4 NP_000791.1 3
NM_001144892.2 NP_001138364.1 3
NM_001144934.1 NP_001138406.1 4
NM_001144935.1 NP_001138407.1 3
NM_001257205.1 NP_001244134.1 3
NM_001257206.1 NP_001244135.1 3
NM_001257207.1 NP_001244136.1 4
NM_001257208.1 NP_001244137.1 3
NM_001257209.1 NP_001244138.1 3
NM_001257210.1 NP_001244139.1 3
NM_001257211.1 NP_001244140.1 3
NM_001257212.1 NP_001244141.1 3
XM_005268390.4 XP_005268447.1 3
XM_011537607.2 XP_011535909.1 4