gRNA Design Details

Target DNA Sequence
GAACCCTTTACCTTCTGGAT
PAM Sequence
CGG
Target locus
Chr.19: 16440874 - 16440896 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 90.57/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EPS15L1
Entrez Gene ID
58513
Gene Name
epidermal growth factor receptor pathway substrate 15 like 1
Gene Aliases
EPS15R
Chromosome Location
Chr.19: 16355244 - 16472012 on GRCh38
UniGene ID
Hs.654639
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001258374.1 NP_001245303.1 4
NM_001258375.1 NP_001245304.1 4
NM_001258376.1 NP_001245305.1 4
NM_021235.2 NP_067058.1 4
XM_017027086.1 XP_016882575.1 4
XM_017027087.1 XP_016882576.1 4
XM_017027088.1 XP_016882577.1 4
XM_017027089.1 XP_016882578.1 4
XM_017027090.1 XP_016882579.1 4
XM_017027091.1 XP_016882580.1 4
XM_017027092.1 XP_016882581.1 4