gRNA Design Details

Target DNA Sequence
TAATGTGGAACAGGACCTTA
PAM Sequence
AGG
Target locus
Chr.1: 51421827 - 51421849 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 85.84/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
EPS15
Entrez Gene ID
2060
Gene Name
epidermal growth factor receptor pathway substrate 15
Gene Aliases
AF-1P, AF1P, MLLT5
Chromosome Location
Chr.1: 51354263 - 51519354 on GRCh38
UniGene ID
Hs.83722
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001159969.1 NP_001153441.1 1
NM_001981.2 NP_001972.1 13
XM_005270618.2 XP_005270675.1 12
XM_017000615.1 XP_016856104.1 13
XM_017000616.1 XP_016856105.1 13
XM_017000617.1 XP_016856106.1 13
XM_017000618.1 XP_016856107.1 12
XM_017000619.1 XP_016856108.1 14
XM_017000620.1 XP_016856109.1 13