gRNA Design Details

Target DNA Sequence
TTCTCCAAGGGGTTCAGGAT
PAM Sequence
AGG
Target locus
Chr.10: 35063017 - 35063039 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 86/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
CUL2
Entrez Gene ID
8453
Gene Name
cullin 2
Gene Aliases
-
Chromosome Location
Chr.10: 35008551 - 35126899 on GRCh38
UniGene ID
Hs.82919
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001198777.1 NP_001185706.1 3
NM_001198778.1 NP_001185707.1 3
NM_001198779.1 NP_001185708.1 3
NM_001324375.1 NP_001311304.1 3
NM_001324376.1 NP_001311305.1 3
NM_003591.3 NP_003582.2 3
XM_011519743.1 XP_011518045.1 5
XM_011519744.1 XP_011518046.1 4
XM_011519745.1 XP_011518047.1 4
XM_011519747.1 XP_011518049.1 4