gRNA Design Details

Target DNA Sequence
TTCTATCTGTTGGGCGAGGT
PAM Sequence
GGG
Target locus
Chr.5: 132864309 - 132864331 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.79/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GDF9
Entrez Gene ID
2661
Gene Name
growth differentiation factor 9
Gene Aliases
-
Chromosome Location
Chr.5: 132861181 - 132866884 on GRCh38
UniGene ID
Hs.25022
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001288825.2 NP_001275754.1 3
NM_001288827.2 NP_001275756.1 3
NM_001288828.2 NP_001275757.1 3
NM_005260.4 NP_005251.1 1
XM_005271957.4 XP_005272014.1 2
XM_011543308.2 XP_011541610.1 2
XM_011543309.1 XP_011541611.1 3